yaboiblessedtho yaboiblessedtho

11-12-2019
Mathematics

contestada

Which expression represents the phrase "the sum of two products each with different coefficients"?

A
4x+7x

B
3x+3y

C
x+y

D
(4+x)(7+x)

Respuesta :

momo121003 momo121003

11-12-2019

The answer should be D
The reason why is because they are in parentheses so it’s going to be a sum and the two different coefficients are 4 and 7

Answer Link

Otras preguntas

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39). Write the base sequence of th

What was the authority of the Church during the Middle Ages? How did it have different roles in European society?

Consider the classification levels of a human. Eukarya Animalia Chordata Mammalia Primates Hominidae Homo sapiens Which is the most specific taxonomic level in

there are 28 students desks in ms.Johnson's .each desk measures 26.17 inches long.if you were to line up all the desks end-to-end,how long would all the desks b

- This is a book in plural

Which line in this excerpt from Amy Lowell's "Lilacs" emphasizes consonance? Lilacs, False blue, White, Purple, Color of lilac, Heart-leaves of lilac all over

The decomposition of dinitrogen pentaoxide has an activation energy of 102 kJ/mol and ΔH°rxn = + 55 kJ/mol. What is the activation energy for the reverse reacti

first sentence please start with .. hace+ time+ que to tell me how long you took a trip . second sentence please tell me what you did there.

A series of dots arranged in the shape of a face will be perceived as a face, not a series of dots. A psychologist studying this phenomenon is applying the prin

find the height of a parallelogram with base 6.75 M and an area of 218.7 square meters