marisela29 marisela29

10-04-2020
English

contestada

__3. Who aids Marlow the most in getting his position as a captain?
a) the Lawyer
b) the Accountant
c) his Aunt
d) Kurtz

Respuesta :

cordesia0 cordesia0

10-04-2020

Answer:

C

Explanation:

his aunt

Answer Link

Otras preguntas

Which statement is true of triangles QRS and MNP? Triangle Q R S. Side Q R is 6, R S is 2, Q S is 6.32. Angle Q is 18.4 degrees, angle S is 71.6 degrees, and an

Bill can paint a room in 3 hours. It would takeTom one more hour than Bill to paint the sameroom. How many hours would it take if theypainted the room together?

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39). Write the base sequence of th

review the map below. Which of the following resources can we found in United States, Canada and Mexicosliveroil coal uranium

3–5 sentences, evaluate the inequality of Japanese Americans in the United States after the war compared to their white neighbors. Choose 1–2 factors to discuss

What gas is the most abundant in our atmosphere

What is the multiplicative inverse of −18?

A researcher studying the attitudes of college students on social norms posts a survey on her webpage. After receiving 150 responses she closes the survey and a

Brian cut a piece of cardboard in the shape of a trapezoid the area of the cut out is 43.5 cm² if the bases are 6 cm And 8.5 cm long what is the height of the t

tyler needs at least $205 or a new video game system. He already saved $30. He earns $7 an hour at his job. Write an solve an inequality to find out how many ho