ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

In recent years, much of California has had drought conditions. Much of our food comes from California, and there are many growing cities in that state. What do

Photos of friends and mementos in your personal space can improve your mood. O A. True OB False

what two steps of the scientific method are going on the entire time?

8.6 more than the product of 3 and a number y as an expression

Read the speech and answer the question. Voluntourism: An Opportunity Too Good to be True A Speech to the Student Body of Evergreen High [1] Picture this: It's

14 points pls show work Evaluate the expression. Show your work.

Given the following weekly net pay amounts, find the average of the net pay amounts. (Round your answer to the nearest cent, and include the $ symbol in your an

Elijah and Riley are playing a board game. Elijah chooses the dragon for his game piece, and Riley chooses the cat for hers. The dragon is about 1/2inch tall, a

the amount of money you get paid after taxes are taken out is called

1. Although my friends realized that I was in danger, they lend a hand. O a. forbade a b. hesitated O c. intervened O d. stopped