Seudónimo Seudónimo

13-01-2021
History

contestada

____________________ is the sacred text of Islam that contains the words of Muhammad and focuses on doctrine and law.

Respuesta :

maciejr2 maciejr2

13-01-2021

Answer:

Hadith. hope that helps :D

Answer Link

Devin098 Devin098

14-01-2021

Answer:

Hadith

Explanation:

Hadith is the sacred text of Islam that contains the words of Muhammad and focuses on doctrine and law.

Answer Link

Otras preguntas

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

Crane Company purchased land as a factory site for $1300000. Crane paid $110000 to tear down two buildings on the land. Salvage was sold for $8000. Legal fees o

* Hello I'm giving ALOT of points to the one who can answer this question with an ANSWER & a STEP-BY-STEP EXPLAINATION so that I can learn from this lesson.

An entrepreneur buts a computer from a manufacturer for $975. Calculate the selling price if he makes a profit of 25%.

In 5 paragraphs. How do you think the US would have been if the US Constitution would have never been created.

WHOEVER ANSWERS FIRST GETS BRAINLIST How did de Niza’s report lead to Coronado’s expedition?

Evaluate the following variable expression 5a + 2b - 17 when a = 3 and b = 4 is?

in the first paragraph which sentence supports the idea that the economy of the south revolved around agriculture and slavery A. People in the north worried th

write 125 as a repeated multplication of 5 then write the power

What does the phrase "a heartbeat away from becoming president" mean?