chanell7 chanell7

11-05-2021
English

contestada

Please help 100 points and brainless please

Please help 100 points and brainless please class=

Respuesta :

taylorvierthaler taylorvierthaler

11-05-2021

Answer:

1. stage directions

2.cast list

3.props

4.stage directions

5.cast list

6.props

Explanation:

hope this helps you out! :)

Answer Link

Аноним Аноним

12-05-2021

1. stage directions

2.cast list

3.props

4.stage directions

5.cast list

6.props

Answer Link

Otras preguntas

Establish the identity. (csc 0+1)(csc 0-1) = cot 0 a. Multiply and write the left side expression as the difference of two squares: ? b. The expression from the

Evaluate: 10 Σn=1 8(1/4) n -1= [?]

The president of the United States is elected by a complicated system known as the Electoral College. This system has been the subject of numerous criticisms th

how many moles of naoh are contained in 15.2l of a 0.205m naoh solution? multiple choice 125 moles naoh 0.0134 moles naoh 3.12 moles naoh 74.1 moles naoh 0.0779

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

what is the best way to approach the criminal justice system, including which methodological approaches are best for understanding and addressing it?

Blue flying fish live in the upper layers of the ocean. Blue flying fish have enlarged pectoral fins that enable them to glide for 4C meters above the ocean sur

How did Hinduism develop? What are the basic beliefs of Hinduism?

What are some of Rosa Parks major achievements?

which xxx will create a spinnernumbermodel with a minimum of 100, a maximum of 500, an initial value display of 100, and a step value of 50?