ababalwebotswana ababalwebotswana

10-06-2021
Mathematics

contestada

consider the equation k over x equals 12 where k is any number between 20 and 65 and X is a positive integer what are the possible values for x

Respuesta :

BasicLurker05 BasicLurker05

10-06-2021

x could be the positive integers 2, 3, 4, or 5

Answer Link

Otras preguntas

(x²–x–6) ÷ (x⁴–ax³–9x²+bx–6)I need an answer quickly!!!!

A researcher is teaching an adult with developmental disabilities how to stuff brochures into envelopes. The researcher teaches the entire behavioral chain as a

Sound source A is located at x = 0, y = 0, and sound source B is located at x = 0, y = 2.3 m. The two sources radiate coherently and in phase. An observer at x

what happens to a neutral atom if it gains or loses electrons

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39). Write the base sequence of th

Fluid Dynamics: How do I find gauge pressure of an air current at various points around a cylinder?A freestream air current of velocity 15m/s flows through a wi

A nursing instructor is developing an education plan for a group of students about schizophrenia and schizoaffective disorders. The instructor identifies that i

What results from the removal of a phosphate group from ATP? the production of mechanical energy the release of energy the creation of energy the absorption of

Students at a high school signed up for pep rally activities. Five-twelfths of the students signed up for tug-of-war, One-third signed up for potato sack races,

Pleaseeeeeeeeeee helppp