saigeguinn1108 saigeguinn1108

12-12-2016
Biology

contestada

What substance diffuses across the membrane in osmosis?

Respuesta :

wdhigh2442 wdhigh2442

12-12-2016

water is the only substance in osmosis

Answer Link

Otras preguntas

Stacy opens an account with a deposit of $100. She deposits an additional $25 every week after opening the account. Determine how much money will be in her acco

Do Birds Really Abandon Their Chicks If Humans Touch Them? 25 points!!

Why do many nurse residency programs also include classes or meeting sessions focused on communication skills and note-taking?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Please help and explain.

Find the length of side x in simplest radical form with a rational denominator.

Ezekiel has a $35 budget for school supplies, and he's already spent half of it on notebooks and binders. Now he needs some pens. If pens only come in packs of

When is the following expression true? (2 points) !(!a || b) || (!a && b) 1) If and only if a and b have different values 2) If and only if a and b have

Wednesday , Tom and , Joewent to an restaurant and ate a dinner. When they were done they paid for the food and left. But Tom and Joe didn't pay for the food. W

A person invest 7900 in an account growing at a rate allowing the money to double every 8 years. How much money would be in the account after 5 years, to the ne