samdoesmath8416 samdoesmath8416

12-11-2021
Mathematics

contestada

A box has 10 red, 5 blue and 5 yellow balls. Draw 6 balls one by one with replacement. Then calculate the probability that

Respuesta :

dgleiberman dgleiberman

12-11-2021

Answer:

I would say its a 16.5 %

Step-by-step explanation:

Answer Link

Otras preguntas

The linear density of a string is 1.9 × 10-4 kg/m. A transverse wave on the string is described by the equation y = (0.034 m) sin[(2.8 m-1)x + (38 s-1)t] What a

Mr. Silverman has taken great pains to fully consider the effectiveness of his classroom arrangement. He has made sure to evenly distribute art supplies at diff

________ is released by the posterior lobe of the pituitary gland in response to a rise in the concentration of electrolytes in the blood, or in response to a f

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

A woman who uses a transdermal contraceptive calls the primary care NP to report that while dressing that morning she discovered that the patch had come off and

Which statement best summarizes the effect diseases had on the Spanish-American War?

Check the punctuation of the following sentence. Hard work gives a person a sense of satisfaction, likewise, it helps to pay the bills. correct incorrect

Alexandria works for a non-profit company that asks for donations to help the homeless people in her community. Recently the database that holds all the contact

What rides did the 13th 14th and 15th amendments guarantee for American citizens?

Which of the following is a way that trees have been negatively impacted by human use?