marquisetyous marquisetyous

11-04-2017
Mathematics

contestada

A map is drawn to scale so that 1.2 cm represents 30 miles.How many miles does 1.4 cm represent?

Respuesta :

Tyrant2103 Tyrant2103

11-04-2017

40 miles hope this help[s

Answer Link

Otras preguntas

Sunk costs are important for optimal decision making. are costs that have already been paid and cannot be recaptured in any significant way. are costs associate

The statement “The sum of twice a number and 18 isgreater than 25" can be expressed asA. 2n + 18 = 25 B. 2(n + 18) > 25Ç. 2(n + 18) > 50 D. 2n + 18 > 2

You run an orphanage and have had a hard time making ends meet. A car dealership offers you a new van worth $15,000 for free if you will falsely report to the g

Tarzan swings on a vine 30.0-m long initially inclined at an angle of 32.9 degrees to the vertical. If he pushes off with a speed of 3.30 m/s, what is his speed

Consider a process in which 100 kJ of energy is transferred reversibly and isothermally as heat to a large block of copper. Calculate the change in entropy of t

WRITE THIS IN YOUR OWN WORDS AND I WILL MARK YOU A BRAINLIEST Major physical features of the Arabain Peninsula, Iraq, and Iran include desert plains and mountai

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

In what year was It's A Wonderful Life released

Consider the following code: String word [] = {"algorithm", "boolean", "char", "double"}; for ( int i =0; i < word.length/2; i++) { word[i] = word[word.lengt

What is the volume of 0.05 mol of neon gas at STP?